EST details — SGN-E394135
Search information |
Request: 394135 | Match: SGN-E394135 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C182935 | Clone name: TUS-40-N21 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182935 is on microarray TOM1 spot ID 1-1-4.2.5.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C133123 [cTOD-4-N13] | Trace: SGN-T142630 | EST: SGN-E330465 | Direction: 5' | Facility: TIGR |
Clone: SGN-C182935 [TUS-40-N21] | Trace: SGN-T195462 | EST: SGN-E394136 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E394135 | Length: 139 bp (940 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E394135 [] (trimmed)
CACGAAAAATTTAACATTTCAATTCATACGTCAACTCAATCAATCAAACTTACAAAAAAAACCCCAAACCTCGAGATTTTTTTTAATTCCAAACC
CGGATTTTTTTTTAAGTGGGCCTTTAAGGAAGCGGGGGGGGGGG
CGGATTTTTTTTTAAGTGGGCCTTTAAGGAAGCGGGGGGGGGGG
Unigenes |
Current Unigene builds | |||||
[SGN-E394135] | SGN-U594821 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195461 [Download][View] | Facility Assigned ID: FA0AAD28CG11FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.757 | Expected Error Rate: 0.0279 | Quality Trim Threshold: 14.5 |