EST details — SGN-E394135

Search information 
Request: 394135Match: SGN-E394135
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182935Clone name: TUS-40-N21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182935 is on microarray TOM1 spot ID 1-1-4.2.5.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C133123 [cTOD-4-N13] Trace: SGN-T142630 EST: SGN-E330465 Direction: 5' Facility: TIGR
Clone: SGN-C182935 [TUS-40-N21] Trace: SGN-T195462 EST: SGN-E394136 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394135Length: 139 bp (940 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394135 [] (trimmed) CACGAAAAATTTAACATTTCAATTCATACGTCAACTCAATCAATCAAACTTACAAAAAAAACCCCAAACCTCGAGATTTTTTTTAATTCCAAACC
CGGATTTTTTTTTAAGTGGGCCTTTAAGGAAGCGGGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394135] SGN-U594821 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195461 [Download][View] Facility Assigned ID: FA0AAD28CG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.757 Expected Error Rate: 0.0279 Quality Trim Threshold: 14.5