EST details — SGN-E392736
| Search information |
| Request: 392736 | Match: SGN-E392736 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C181765 | Clone name: TUS-37-N3 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C181765 is on microarray TOM1 spot ID 1-1-6.2.12.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C148667 [cTOF-8-P14] | Trace: SGN-T154943 | EST: SGN-E342544 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C181765 [TUS-37-N3] | Trace: SGN-T194250 | EST: SGN-E392924 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E392736 | Length: 213 bp (825 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E392736 [] (trimmed)
GATAACTTTCATTTCTTCTATTTGATGCTTTTCTCTCTTCCTTTAAATCTCTTCTTGTATGAAATTAGTACTAATTCCCTTCATCTAGATTTTTT
TAAATCAATTTCTATGTGATTAATTCCTTCTTCAATATTAAGTTTTTTTTTTTTTTTTTTTTAATTAAGGGGATTGATCTAAAGATATGGTTCGA
GGTATAAGCCAGAAGAGGTGTAT
TAAATCAATTTCTATGTGATTAATTCCTTCTTCAATATTAAGTTTTTTTTTTTTTTTTTTTTAATTAAGGGGATTGATCTAAAGATATGGTTCGA
GGTATAAGCCAGAAGAGGTGTAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E392736] | SGN-U587396 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T194062 [Download][View] | Facility Assigned ID: FA0AAD25CG02RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.827 | Expected Error Rate: 0.0005 | Quality Trim Threshold: 14.5 |


