Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E391068

Search information 
Request: 391068Match: SGN-E391068
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185802Clone name: TUS-48-F8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185802 is on microarray TOM1 spot ID 1-1-1.2.7.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185802 [TUS-48-F8] Trace: SGN-T192736 EST: SGN-E391410 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391068Length: 329 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391068 [] (trimmed) AAATAAAACAAATGCCATTTATTCAAAAAATGAAGGGAACCCAACAAACTAAAATTACTACACTTTCTCCAAAAAAAAACTTTAAGGAGGATTCC
AACAACCTTCCCCCAAAAACATGGGGCCATTTATACATTACATAATTAAAATTTGGCATTTTAATATCCTTCGCGCTTTGTAACCAATAAAACTG
ACGCCCTGCACTTTACAAACATTGTCAAATCCGATAAAACCGACCCATCCCGAAGGGTAACCCTTCTTTCCCTCCCGCCCCTCACCCAAAACCTG
GGTTCCCCCGGTGCCCCCAAACTTGGGCAACTTCCACATGGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391068] SGN-U598280 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192394 [Download][View] Facility Assigned ID: FA0AAD36DC04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.879 Expected Error Rate: 0.0341 Quality Trim Threshold: 14.5