EST details — SGN-E379199

Search information 
Request: 379199Match: SGN-E379199
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167967Clone name: TUS-1-O5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167967 [TUS-1-O5] Trace: SGN-T69 EST: SGN-E379620 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379199Length: 356 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379199 [] (trimmed) ACTTAATTTGATAATTACTAGAGATTTTTTTCTTAATTATTTTCTAATTTTATAGAGAGGCCCAATCAATTTCATGAGATGGATACTTCTGCAAC
AAAAAATTTTCTGACATGTCCCAAGTTGGCTCTTCCTCAGTGAACTCCGGGAATATCAGTTCGGTCACCGGCGATGATCCACCGGAACCGGAATG
GGACCCGTCACTTTCGGATCCAACTTCTGCTGTTTTGCTCTCCTCTTCCTCCATCTTCACCACCGCCGCTTTCTCCGCCGACAACCCTTTGGTTT
TCTTCTTCTTAGAGTCAATGCTCTTCCCCTGTGCCAAGCTTTGGCATATGTCCTTTAGCTTAGCATCAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379199] SGN-U579555 Tomato 200607 Build 2 111 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T543 [Download][View] Facility Assigned ID: 231_G05_TUS01O5.Td_035.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0182 Quality Trim Threshold: 20.5