EST details — SGN-E378476

Search information 
Request: 378476Match: SGN-E378476
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185237Clone name: TUS-46-N19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185237 is on microarray TOM1 spot ID 1-1-6.2.11.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76465 [cLES-18-C10] Trace: SGN-T101688 EST: SGN-E289246 Direction: 5' Facility: TIGR
Clone: SGN-C185237 [TUS-46-N19] Trace: SGN-T199062 EST: SGN-E397736 Direction: 3' Facility: INRA
Clone: SGN-C185237 [TUS-46-N19] Trace: SGN-T199063 EST: SGN-E397737 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378476Length: 272 bp (1155 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378476 [] (trimmed) CTCTCTCTCTAAAAAACTTCCAAATTCTATCCAAAGAGAAAAAAAAAAAATAAAAAAAAATTCGGGCCCACAGATCTACATTTTCCACAAGATCT
CTTTGAAATGAATTCACCAAATATCAATTCTTCTCAAAGATGTATCAGCAGCAATATTAATATTATTATCAGTAATAAAGATGATTGCAAAACCC
CAAATCCTTCCCTTTTTTAATCCCAAAAAACCTCAAAAGGCCCGGTGGCCCCAAAAAACCCAGAAGGGGAATTTCCGCCCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378476] SGN-U596744 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1882 [Download][View] Facility Assigned ID: TUS46N19.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.579 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5