Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E373512

Search information 
Request: 373512Match: SGN-E373512
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179322Clone name: TUS-31-H8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179322 is on microarray TOM1 spot ID 1-1-1.4.2.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77351 [cLES-20-K3] Trace: SGN-T102014 EST: SGN-E290335 Direction: 5' Facility: TIGR
Clone: SGN-C179322 [TUS-31-H8] Trace: SGN-T185651 EST: SGN-E373513 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373512Length: 269 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373512 [] (trimmed) ACAAATTATAAGAGGCTGAAATGAATATATTATCGCTGTCAGCCTATTATTGCAGTGAGTTCTTTCCTTCTTTGATGATTCCCATTATCTCCCAC
TAATCCATTTCCCCGATTCAACCAATCCCAAACCTTACGGGAAATAATTGTGTCTTGATTGATTCATGACTAACTCTTTTAGGAAGAGGTATGAA
GGCTGTTTTCCCCCTCTATTTTATTATGAGATGGGATACTATCCTCACCCAAAAGCAACAATAACAATTACGCCTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373512] SGN-U588740 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185650 [Download][View] Facility Assigned ID: FA0AAD19DD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0252 Quality Trim Threshold: 14.5