EST details — SGN-E372500

Search information 
Request: 372500Match: SGN-E372500
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179736Clone name: TUS-32-I14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179736 is on microarray TOM1 spot ID 1-1-3.1.1.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80332 [cLET-11-O2] Trace: SGN-T105155 EST: SGN-E292692 Direction: 5' Facility: TIGR
Clone: SGN-C179736 [TUS-32-I14] Trace: SGN-T185996 EST: SGN-E372501 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372500Length: 411 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372500 [] (trimmed) CAGGATGCTTGGGAAGAAAATGAAATCTCATTACCCTAGCTTTATTTACGACTTCTGAGTGTATGGCCTTCAGAGACAGAATGAAGGCAGAATTA
GCAGCAGCAACAGTTGGGAAGGACTACTGTTAGATTCAAACTGTGTGCTTCCGCTAGTCACAGGTGCACTCTTCCAATCTCTAACAGATTGGTTT
ACCATCAGCATTTGAAGTCTCAATTGTAAAATTGATTGGGGTCAATGTCTGCACGAGCACTTGACGTGTTTGGCAGCTGCTTTCTGTTCCCTGAT
CGTTAATTGGCCTTCGATCCACCTGTTTGCACAAATCCCCCCCAGTGATATTATGCTTCTACCTTGATCTTGTCGTAACAGGATTGGATGTATGT
ACGACACTATCTTGGGGTAGTGACTGCAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372500] SGN-U595652 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185995 [Download][View] Facility Assigned ID: FA0AAD20BE07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5