EST details — SGN-E372021

Search information 
Request: 372021Match: SGN-E372021
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179112Clone name: TUS-30-O14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179112 is on microarray TOM1 spot ID 1-1-3.3.2.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78841 [cLES-6-O6] Trace: SGN-T98452 EST: SGN-E287000 Direction: 5' Facility: TIGR
Clone: SGN-C179112 [TUS-30-O14] Trace: SGN-T184636 EST: SGN-E372022 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372021Length: 614 bp (925 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372021 [] (trimmed) AAGAATAAACATGACATTACTAATATCTCAATCAAACAGGAAGAAACATTATTGGCTCTCGTAGAGTGTACGTACAATTTACATATACAGACAAC
AATATATTACAGCAATAAAACGACATTTGACTTTAGGCCACTCTTTCTATAATCTTAGTACATATAACAACGGAGCAAGCATTGATAAGACATGA
ACGTGACTGTCCATATCAATGGGCACAAATTTCATCCCCCCCCCCCCCCCCCATGTATACACAATTAAGGAGAAGTTTCAAATTCCGGCCCTACA
TTCTGGTGGGGGAACGGGGTTTCTCGATTTGTCTGTGCAATAATCATAGATCATGTGATTCATTCGAACCCAACGATATTGCCTTGCTTGTACTG
GGCTCAGTTGTTGATAAAAAGGTCCTTCCCACCAATTACTTGGGTTGGAGGCACAATTTGCTGGTCCTGGCATTGCACATCCTTCAATGTCAAAA
TCCTTGTAGTATGCGTAAAATGGGGATTTGCTCCAATTTATTTTCTCTAAGCCACCTCTTGTAGCCCAGTCGTCAGCTTCCCACAATGTTGAGTA
GACACCCATGGGTTGAAATTTGGGGGAATGGGATTCCTTTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372021] SGN-U596633 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184635 [Download][View] Facility Assigned ID: FA0AAD18BH07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5