EST details — SGN-E367508

Search information 
Request: 367508Match: SGN-E367508
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111035Clone name: cLPT-7-E16
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367508Length: 462 bp (986 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367508 [] (trimmed) AACCCCTCCTAGACACCAACTCCTGACCCCGGTTCTCCAAGCACTCCAGGAGGTGGTGGATACTATTCTTCCCCTACTCCTACTACTCCTACACC
TAGTACACCATCCACCCCCTCTACGCCTACTATTGAAACACCACCAACTCCTACCGTTGATCCTGGAACTCCAAGCACTCCGGGGGGTGGTGGTT
ACTATCCTTCGTCTACACCTACACCTACACCTAGTACCCCTTCTACACCTACTATTGAAACACCACCTACTTCTACCATTGACCCTGGCACGCCA
AGCACTTCAGGTGGCGGTGGTTACTATCCTTCGTCTACACCTACACCTAGTACCCCTTCTACACCTACTATTGAAACACCACCAACTCCTACCGT
TGACCCTGGCACGCCAAGCACTTCGGGGGGTGGTGGATACTATACTTCCTCTACACCTACTACCCCGTCTACACCTACCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367508] SGN-U589648 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179070 [Download][View] Facility Assigned ID: TPTAZ32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0224 Quality Trim Threshold: 14.5