EST details — SGN-E364118
| Search information |
| Request: 364118 | Match: SGN-E364118 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C105021 | Clone name: cLPP-16-M9 |
| ||
| Library Name: cLPP | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: pollen
Development Stage: pollen collected from open flowers
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C194743 [TUS-71-J21] | Trace: SGN-T348508 | EST: SGN-E547633 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C194743 [TUS-71-J21] | Trace: SGN-T348509 | EST: SGN-E547634 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E364118 | Length: 172 bp (862 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E364118 [] (trimmed)
CACCATGGCAGATAATCAGCAACCTATTTTGCAAAAAGATGATGCACAACATCCGATGGCAAAGCTGAACCGTCTGCACTTTTGGCTTTTGGTGG
CACTCAACATTGTTTTCCTTCTCGTTGGTCAAGCTGCTGCTGTAATTTTGGGAAGATTTTACTATGAGAAGGGTGGA
CACTCAACATTGTTTTCCTTCTCGTTGGTCAAGCTGCTGCTGTAATTTTGGGAAGATTTTACTATGAGAAGGGTGGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E364118] | SGN-U583724 | Tomato 200607 | Build 2 | 12 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T176500 [Download][View] | Facility Assigned ID: TPOCI77TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.966 | Expected Error Rate: 0.0208 | Quality Trim Threshold: 20.5 |
Working
