Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E363263

Search information 
Request: 363263Match: SGN-E363263
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107172Clone name: cLPP-4-I1
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194329 [TUS-70-I15] Trace: SGN-T347797 EST: SGN-E546922 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194329 [TUS-70-I15] Trace: SGN-T347798 EST: SGN-E546923 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363263Length: 248 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E363263 [] (trimmed) GAACAACATCCAGGTGTATCCAAACTCATGGGCAGCAATAATGTTGACATTTGACAATGCAGGAATGTGGAACTTGAGGTCAGAGATGTGGGAGA
AGACTTATTTGGGAGAGCAAATGTACTTCAGCGTTCTCTTTCTATCTAATAATAAAGGGGACGGCTTAACTATTAATGGATTCCATGTATTTGTT
TTCCTTCCCCCAAAAAATCAATGAATAAAAAGTTTTTTCTTTCATTCAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363263] SGN-U578153 Tomato 200607 Build 2 112 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175700 [Download][View] Facility Assigned ID: TPOAM49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0038 Quality Trim Threshold: 12.5