EST details — SGN-E362998

Search information 
Request: 362998Match: SGN-E362998
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106679Clone name: cLPP-2-O22
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180251 [TUS-33-O1] Trace: SGN-T186433 EST: SGN-E373981 Direction: 3' Facility: INRA
Clone: SGN-C180251 [TUS-33-O1] Trace: SGN-T186434 EST: SGN-E373982 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362998Length: 416 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362998 [] (trimmed) AAAATCAAATCGACTATTAAAATCAAACATGGCAAAAGCTATCATTCTACTCTATACCCATAAACGATTAGACTGTCGCCAATTTCGCCGTTGCC
GACGTTGAAACGTTCAACGTCGAAAGCAAAGTCTTTTGTGATACCTGCCGTCTTGGTTTCGTCACCTCCCTCATCAATACCCTTGAAGGTGCCAC
GGTGCGTATGACATGCAAGGACATGGAGACACACAACGAGACATTTACAACTGAAGGCAAAACGGATAGTATTGGCAAATATACATTGAAAGTTG
AAGGTGACCATGAGAATGATATTTGTGAGGTTACATTGGTGAACAGTCCAAAAGATGATTGCAAAGAAGTTGTTCCAGATATGGTTAATAACAGA
GTTATTTGCAGTAAAAATGTAAGGATGCACAATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362998] SGN-U587335 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173858 [Download][View] Facility Assigned ID: TPOAF95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0244 Quality Trim Threshold: 14.5