Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E362527

Search information 
Request: 362527Match: SGN-E362527
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106007Clone name: cLPP-1-I23
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194241 [TUS-70-E23] Trace: SGN-T347646 EST: SGN-E546771 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194241 [TUS-70-E23] Trace: SGN-T347647 EST: SGN-E546772 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362527Length: 516 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362527 [] (trimmed) GAGGCTTATTTACCAGGTATACCAGATAGAAGAAATAGTTCCATCCAGCATTTCAATCAGGCCATTGTTATTGGATCCATTGCTATGGGCTGCAT
ATGAGGAGTTGTGTATACTAGGTGCTGCAGAAGAAGCAGCTGCAGTTTTTGGGGAAGCATCTTTGCTTTGCATTCAGAAACAACACATAGACCAA
GGGAACCAATCTCAAAATTTACAAACATCCACTGATGATCAGAATGTAGCTTCTACGAATATTGTCTCAGGCGACATCAGCCCTAGGCAATCAAA
ACATACACACAGCAATAATCTTCGAGAAATGTCTGGAAATTATAATGGAGCAGCTGCTATCCAGAATTTAGGTGGGGTTTCTACTAACATGTCAT
TCTACAACACTCCCTCACCAATGGCATCACAGTTGTCAGGAGTGGTTCCACCTCCAGTTTGTAGAAATTTTCAGCAAAATGGAACTAATGCATCT
GTGGCTGGTGCTGATAATTCTCCACGAGCAACTGTCAATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362527] SGN-U595863 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174588 [Download][View] Facility Assigned ID: TPOAA60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5