EST details — SGN-E362511

Search information 
Request: 362511Match: SGN-E362511
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105925Clone name: cLPP-1-E5
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194217 [TUS-70-D23] Trace: SGN-T347604 EST: SGN-E546729 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194217 [TUS-70-D23] Trace: SGN-T347605 EST: SGN-E546730 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362511Length: 427 bp (1082 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362511 [] (trimmed) CAAAAACCTGCAAACTCTCATTCCATCCTACTTCTTACCTATTTAGTTTTCTTGTTACTGTTATCTATATATAGCAAATATTGCTTTCTGTTTAA
AAAGTATCCGGAATTCACGTGCCTTTCTTACCCCCTTTTCCTTTTCCTGTTATAAAGATTTGATTTTTTTAGTAAGAGAGCATGTGAATGAGCTT
AATTTGAAGTGTTTTAGAGAAAAAGAGGGTAAAGATTGAATCTTTATGAGGTTTAGTGAGATGGGTGTGTAGTGGTTTTGTGGATTGGTCATTTT
GGGTTTGGTAATTGGAGGAAAAGGGTATCCAGAGGAGGATTTAGTGAAGGCATTGCCTGGACAACCTAAGGTTGGGTTTAGGCAATATGCATGGT
ATGTAGAAGTGGATGTGAAAGCTGGGAGGAGTTTGTTTTACTACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362511] SGN-U589550 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174572 [Download][View] Facility Assigned ID: TPOAA27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5