EST details — SGN-E361384

Search information 
Request: 361384Match: SGN-E361384
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107709Clone name: cLPP-6-I12
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194396 [TUS-70-L10] Trace: SGN-T347912 EST: SGN-E547037 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194396 [TUS-70-L10] Trace: SGN-T347913 EST: SGN-E547038 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E361384Length: 458 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E361384 [] (trimmed) TTCTCTCACTTTCCCCTTTTGAAACCCTAATTATCTTCCTCAACCCGACTCACTGTTTCTCAGTTTCAATTTCTCTCCAATTTTCCGTAACTTTC
TGTAATCTCCTGAATGCAGATATAGATATATAGTAGCAAGGTTTGATAAATACTTGATAGAAATGTATAGAGATCGAGGAGGTGGCGGAGGAGGA
GGTGGTGGTTCATCCAAGTCGGAGATGATCGGTGGACCGTTGGATCGGAAAAGAATTAACGATGCGTTGGATAAGCACTTAGAGAAGTTGTCGCC
TTCTACATCTAGGTCTTTGAAGGATAAAGCTGTTCCCTCTACGTCAACCGGTGGTGGTGGTGGTGCTGGAAAATCACATTTTGATCATCGTAATA
CCAACAAAAACAAGTGCTCCGATGAGGAATCTGAAACGGACAGTGAAGAGTCTGATGTTAGTGGTTCTGATGGGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E361384] SGN-U581563 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175156 [Download][View] Facility Assigned ID: TPOAV54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5