EST details — SGN-E360865

Search information 
Request: 360865Match: SGN-E360865
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108103Clone name: cLPP-7-N6
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360865Length: 416 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E360865 [] (trimmed) GAAACAGCAGCATCTCGGCGATTGTTAGAAAATGAAGACAATGACGAGCAGCAAGCCAGCAATACAAAGAGCGGAGGATATCCTGCATGGCTTTC
TGCTAGTGATAGAAAATTGTTGGCTTTTAGCAATAACGGCAACCCAGCACCAAACGCTGTGGTAGCTAAGGATGGATCTGGACAATTTAACACAA
TTGCAGCAGCTCTGGCTGCGTACCCTAAGAACCTAAAAGGAAGGTATACTATATATGTGAAGGCCGGAATTTATGATGAATACATAACTGTCACA
AAAGATCAAGTTAACATATTTATGTATGGAGATGGACCGCGAAAGACGATAGTTACAGGACACAAATCCGCACTTGCTGGTGTGTCTACTTATCA
GAGTGCTTCCTTCAGTGCCATTGGAAATGGATTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360865] SGN-U597443 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173268 [Download][View] Facility Assigned ID: TPOBB75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5