EST details — SGN-E359950

Search information 
Request: 359950Match: SGN-E359950
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108592Clone name: cLPP-9-I3
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194515 [TUS-71-A9] Trace: SGN-T348116 EST: SGN-E547241 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194515 [TUS-71-A9] Trace: SGN-T348117 EST: SGN-E547242 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359950Length: 482 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359950 [] (trimmed) AATCTCATATAGCATGTGGGAAGTTAAAGGTGATGTTTCTGGCCCAACTCAAATTCCAATGGCTTGTAAGGATTCTGTAGCAATGTTTTTCATGT
TTGATCTCACAAGTAGATGTACACTCAGTAGTGTCCTTAGCTGGCATCAACAAGCACGTCAATGGAATCAGACAGCAACTCCTGTAATGATAGGG
ACAAAGTTTGATGATTTTGTGAAATTGCCATTGGATCTTCAATGGACAATTGCAAGTCAGGCAAGAGCATATGCAAAGGCACTAAATGCACCATT
ATTTTTCTCAAGTGCAACATACAACATTAATGTGAACAAGATATTCAAGTTCATCACTGCTAAACTCTTCAATTTACCATGGTCATTGGAGAGAA
ATCTCACAATTGGTGAACCTATCATTGACTTTTAGGTTTAATTTCTCTTATTTTCTGTAATTAAAAAAAAAAGAAGAAAAACGGTTTGCTTTTTT
TTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359950] SGN-U564362 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T172613 [Download][View] Facility Assigned ID: TPOBG50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5