EST details — SGN-E358721

Search information 
Request: 358721Match: SGN-E358721
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102202Clone name: cLHT-24-A5
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194005 [TUS-69-L3] Trace: SGN-T347240 EST: SGN-E546365 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358721Length: 342 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358721 [] (trimmed) GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTCTTTCAATTGCTATCAAAAAAACAATGGTCTTTCTATTACTTATAATTACTGCTACAAAT
TCAACAATATGACACTAAAAATGTATTGAATTTCATATCAAAGCCTTCTCTATTTACATATTCCCAACAAAATGGCCTCTTTTTTTTATGCCATA
TTTCTCGATATAGGCCGCGTTCTCTTAAGCCATCAATCTTCTACTTCTAGTCGACTGTTCTACGACCGAACTTGCTCTTTTTTTTAGTGCTCCCT
TCCCACTCAACAAGTAATAATTTAAAAAACGACATTATTGTCTTCTTCGTCTAGTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358721] SGN-U589513 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170281 [Download][View] Facility Assigned ID: THTDO03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5