EST details — SGN-E358518

Search information 
Request: 358518Match: SGN-E358518
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101854Clone name: cLHT-22-E9
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193923 [TUS-69-H17] Trace: SGN-T347100 EST: SGN-E546225 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193923 [TUS-69-H17] Trace: SGN-T350211 EST: SGN-E549336 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358518Length: 438 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358518 [] (trimmed) AGCAATTTGCTGTCTTTATGATGTGACAAGTTGACCGAGCAAGAGAAGCTGCCCATCTAAGTCGTTTTATTTATAATTTTCGAAGATGGAAAAAT
GTCTCTTTCCCTAAGCCTGTTTATCCATTAGTACATCCTGCCGTGCTGGTGGAAACTTTTGAGGAAGGAGAAAGTGTCGCCCACTATGTTGATGA
ACTTCAGGGTCATGAGCGACTTAAGAGTGCTCTTGCTCATATTGGAACTCATGCCCTTCTCAAGATGCTTCTGGTTGACAATTTCATGCATGCAG
ACATGCATCCAGGAAATATTCTTGTCCGTGTACAACAGCACAAGTCCTCTCAGAAACAGATATTCAAGTCAAAGCCACATGTGATTTTCCTTGAT
GTAGGCATGACTGCTGAACTTTCTCAGAATGATAAGTTGAATTTGCTTGAATTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358518] SGN-U566686 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171003 [Download][View] Facility Assigned ID: THTDG29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5