EST details — SGN-E357567

Search information 
Request: 357567Match: SGN-E357567
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C164323Clone name: cTOS-23-H4
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E357567Length: 376 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E357567 [] (trimmed) GCCCCACCTGGCACTAAAATGGCACGTATTTGGGGTCGTACTAATTGCAACTTTGATGGTGCTGGAAGAGGTTGGTGCCAGACTGGTGATTGTGG
TGGAGTCCTGGATTGCAAAGGATGGGGTAAACCACCAAACACCTTAGCTGAATACGCTTTGAACCAGTTTGGTAACCTAGATTTTTGGGATATTT
CTGTTATTGATGGATTCAACATCCCTATGTCTTTTGGCCCAACTAAGCCTGGCCCTGGAAAATGTCATCCAATTCCATGCACAGCCCATATAAAC
CGGGAATGGCCTGGTTCACTTAAGGTACCTGGAAGATGTAACCACCCTTGTACCACATTCCGAAGACCACCATATTGGTGGAATCACGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E357567] SGN-U590241 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T169128 [Download][View] Facility Assigned ID: TSCDN38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5