EST details — SGN-E354253

Search information 
Request: 354253Match: SGN-E354253
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C161628Clone name: cTOS-16-D19
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E354253Length: 307 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E354253 [] (trimmed) GCCGTAACGAATATTTCTCCGGTGGAGACTGCATTGGATTTGGCTTTAACAGAAAGTGCTTTTGCACTAAGGCTTGTTAATTAATTAATTAATTA
ATTAATTAGTGTCATGAAAATGACACTAAATTAATTTAATTAATTAGTTCATTAATCCATCTCTAAGTTAGTTTTGTTTTAGGCAATAATAAAAT
GTAGTAGTGTTTTTTTTCTTTTCTAAAGGGCATTATGCCCTTCAGGGTTGTAGTCTTTCTTCGAAATCTGTGTGAACATGAGGTGTTTTGTGCAT
CGATTGATTAGTAATTCAAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E354253] SGN-U570726 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T166821 [Download][View] Facility Assigned ID: TSCCK22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5