EST details — SGN-E348247
| Search information |
| Request: 348247 | Match: SGN-E348247 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C144767 | Clone name: cTOF-27-G2 |
| ||
| Library Name: cTOF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E348247 | Length: 196 bp (903 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E348247 [] (trimmed)
GGGTACTTCCAGATTGATGGAAAGATGAAACTCGGAATGACGATAAATGGCGCCTTCAAGCATGCCTTAGCTACTTGGAAATCTTGGGTTGAAAA
GAAGGTCAACACTGATAGGACACGTGTATTCTTTCGGACTTTCGAAGCTACTCATTGGAGGTGTGCTTAATTTTCTGATATAACCTGCTCGTCTC
CCCATT
GAAGGTCAACACTGATAGGACACGTGTATTCTTTCGGACTTTCGAAGCTACTCATTGGAGGTGTGCTTAATTTTCTGATATAACCTGCTCGTCTC
CCCATT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E348247] | SGN-U576414 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T159851 [Download][View] | Facility Assigned ID: TOFEB37TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.945 | Expected Error Rate: 0.0005 | Quality Trim Threshold: 14.5 |


