EST details — SGN-E342184

Search information 
Request: 342184Match: SGN-E342184
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C139892Clone name: cTOF-10-D4
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E342184Length: 312 bp (941 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E342184 [] (trimmed) TGCCTTGCATAGCTTTTGGACGATTCGATGATTCATTCAGCTTAGGGTCTATTAAGGCCTATATTGCTGAATTCATCTCTACTTTGCTCTTTGTC
TTCGCCGGAGTTGGTTCAGCTATTGCTTACAACAAGGTGACAGCTGATGCTGCTCTTGATCCGTCTGGGCTAGTAGCTGTTGCAGTTTGCCATGG
ATTCCCACTGTTCGTGGCTGGTGCCATTGCTGCTAATATCTCCGGTGGTCACGACAACCCTGTCGTTACATGAGGATTGCCTCTGGGTAGCCTAT
TCACCCTGTCTCACCGGTCTATTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E342184] SGN-U593098 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T155455 [Download][View] Facility Assigned ID: TOFBN14THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5