Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E340794

Search information 
Request: 340794Match: SGN-E340794
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147692Clone name: cTOF-5-K22
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E340794Length: 192 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E340794 [] (trimmed) GGGAGAACTTAAGCATGAACATGCTCAACTTTTCCTTCTAAACATGAATGAATGAATACTAGTGTGCAATGTGTGTGTGATTGGAAGTTGTTTAT
CATTTGTTTTATTAAGTGGCTTTTCATATCTCTTAAGTTTGTCTCGACACTTGATGTAATCTTATTTTCAAACAAGTTAAAGCTTGAATAATTGA
TG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E340794] SGN-U571540 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153817 [Download][View] Facility Assigned ID: TOFAR71THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.885 Expected Error Rate: 0.0008 Quality Trim Threshold: 12.5