EST details — SGN-E337179

Search information 
Request: 337179Match: SGN-E337179
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C139388Clone name: cTOE-7-J18
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: Alias clone SGN-C186239 is on microarray TOM1: SGN-S1-1-4.4.5.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E337179Length: 312 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E337179 [] (trimmed) GGGTTATATGCCCTAGTCCACTTAGGGTACCCGGAGGATGTAACAACCCTTGTACCACGTTCGGAGGACAACAATATTGTTGTACTCAAGGCCCA
TGTGGTCCTACAAAATTTTCGAGATTTTTCAAACAAAGGTGCCCTAATGCGTATAGCTACCCTCAAGATGATCCTACTAGCTTATTCACTTGCCC
TAGTGGTAGTACAAATTATAGGGTTGTTTTTTGCCCATAATTGATGCCACAATAAAGCATATTTTGCTACAAATTGAATGGTATGAAAAAATTAC
CAAAATAATAAGCATCTTAAACGGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E337179] SGN-U578601 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T149046 [Download][View] Facility Assigned ID: TAIBB57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0133 Quality Trim Threshold: 12.5