EST details — SGN-E336107
| Search information |
| Request: 336107 | Match: SGN-E336107 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C135200 | Clone name: cTOE-12-O6 |
| ||
| Library Name: cTOE | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E336107 | Length: 180 bp (960 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E336107 [] (trimmed)
TCCACCGGAAAACCCTCAAATTCTTCTTCTCTTAAGAAAGCCCAATTCCGATGGGTTCTCGTTCAAAATTAAGCCCCAGTAGCTTATCGATGAGA
AGAACAAGAAGATCTACCCCTCACAAAAAAACATGCAAATCTCAAAATCTTGTTGACGTTGACGGCGGTTCCGTTTCTGAAAAAT
AGAACAAGAAGATCTACCCCTCACAAAAAAACATGCAAATCTCAAAATCTTGTTGACGTTGACGGCGGTTCCGTTTCTGAAAAAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E336107] | SGN-U583440 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T150023 [Download][View] | Facility Assigned ID: TAIBT87TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.930 | Expected Error Rate: 0.0287 | Quality Trim Threshold: 14.5 |


