EST details — SGN-E336092

Search information 
Request: 336092Match: SGN-E336092
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135130Clone name: cTOE-12-G24
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336092Length: 223 bp (800 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336092 [] (trimmed) TTCGGCACGAGGCTTTAACCATCTCCTCGAGATCCTCGCCCACTTCCGTCGTCGGGAAACCGCTGCTGCTCACGCCGAAACCGTCATAGAAGTAT
AATTCCCGGCTGATTTATAAAGTTATAGAAAAGATCCCTGTCGAAATGAGTAACGGGGAGCTACTTCAAATCGAACCAGTAGAAATTACATATAC
ATTCGAATTGAAGAAGCAGATCTCATGCTCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336092] SGN-U566477 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150008 [Download][View] Facility Assigned ID: TAIBT48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0333 Quality Trim Threshold: 14.5