EST details — SGN-E335669

Search information 
Request: 335669Match: SGN-E335669
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C139580Clone name: cTOE-8-G15
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E335669Length: 301 bp (964 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E335669 [] (trimmed) CTCCAAAAACTCCTTGTTTTTACATTCCAAAGCTTCGATCTTTCTCTCTCTGCATTGGACAAAGTTCTAGGGTTTCATCAACAGCTTCATAAATG
GATAGCTCGTATTGAGCGGCGATCGCCGCTAGTTATTATCTCGGCGTTCGATTCCTCCTGCTGTGGAAGATCGCCATTGATTCATCATCATGTTC
GAAGCACATGTTCTGCATTTGCTTCGAAGATATCTTGGTGAATATGTCCATGGATTGTCGGCGGAGGCTTTGAGAATCACCGTATGGCAAAGCGA
TGTGGTTCTCAAGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E335669] SGN-U598335 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T149282 [Download][View] Facility Assigned ID: TAIBC44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0146 Quality Trim Threshold: 14.5