EST details — SGN-E335198

Search information 
Request: 335198Match: SGN-E335198
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C136876Clone name: cTOE-1-L16
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E335198Length: 199 bp (847 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E335198 [] (trimmed) GACCGACCGAACCGACTTCGACCGAACCGAACCGAAGGACTTCGAAAATTTACCGACCGAATTTTGAAGTTCCGTCGGCGTTTGATGACCGAAGA
AGGGAAGAGGAAGGTGTTAAATTCGACCGATAAAGACGTCGTCGTTTTGACCGGATAGGAATTTCAGTGACTTTGTAGAGGATAATAAGTATGTG
ATGGTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E335198] SGN-U586643 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T147456 [Download][View] Facility Assigned ID: TAIAD68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0309 Quality Trim Threshold: 14.5