EST details — SGN-E331055

Search information 
Request: 331055Match: SGN-E331055
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C133478Clone name: cTOD-6-A22
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E331055Length: 371 bp (861 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E331055 [] (trimmed) GGGCTGTTGTTTGTGGTCTCTACCGACAAGGGAAGATAAATTTCCATCCAAGGGATGAAGAAGTTTTGGAAGAAGCTGATAAAGTATGTTCAACA
TTAAATATTGCAGTTGTGTCACCCATATGAATAAAATAATCCAACTGTAGATGTTAAATTAACTTGGACTATCTCTGCAGAGAAACAAAAATTTA
TACACTAGCTTCTTTTGGGGACCTAGTTTGTGAAAGTATAATGATACACACAATACACTGATTTTATACTGATCTATTATTCTGCGTCAGTCCTT
TAAAAATATTGTATGCTTATATTGATTTGTAAACTGTACATCTATTATAAGCCATCGTACATTATTCTCAAGTAGAAGAAAGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E331055] SGN-U598511 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T143026 [Download][View] Facility Assigned ID: TFDAV11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5