| SGN ID: SGN-C119171 | Clone name: cTOB-16-A1 |  | Order Clone |
|
| Library Name: cTOB | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E319104 | Length: 359 bp (827 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E319104 [] (trimmed)
GAGCTGTTCATATGGCTTGTTTGCTCTGCCAGAGGGTTCAAGAAAATTTGTTATCTGAAACCTCTGAACATGTTCATTCTAAGGAGGATGACTCT
CCTGTCACAATTGCTGATTGGAGCGTCCAAGCAATTGTCAGCTGGGTACTGTCCGAGGCTTATGGCAGTAACGTCTCTATTGTTGCTGAAGAAGA
TGTAGAAGCTCTTTCCAAAGCTAGCGCAGCTGGTCTGTTAGAAGCAACAGTAAGAACTGTGAATGAGTGTCTAGCCGATGCTCCTCGTTTTGGAC
TGAAAGGTCCTGGTACTGATCTGGATGCTAAAGCTGTCCTTGAGGCCATAAGCCGTTACACCTTATCACGTGCC
[BLAST] [AA Translate]
| SGN-ID: SGN-T132579 [Download][View] |
Facility Assigned ID: TFBCI01TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.956 |
Expected Error Rate: 0.0184 |
Quality Trim Threshold: 14.5 |