Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E318005

Search information 
Request: 318005Match: SGN-E318005
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C116522Clone name: cTOA-30-B6
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318005Length: 448 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318005 [] (trimmed) GGTAAGAAGGTAGCCGGCGCCTTTCGAAGCACTTTCTATTTCTAGTTAGCGCTGTTTTTTGATTGCAGCTAGCGCGCTTGACTAATAAGATAGAA
AGGGCCTTTCTCGCTTGTTTAGTAAAGTCAAGTTTTTGGCCTTATCTTGCAGGTGACGACGACGTCGAGTTGACGGCAGAGAAAGACTCGGCATT
CAGGCGAGCCACCCGGTGGTGTGGTACGTAGTGGGTTTAGTACGCCCCGCCCAAACAAACGGCTCCTGAGCTCTTGGCCCGCAACGGTGTAAAGT
TTGGTGAGGCTGTGTGGTTCAAGGCCGGATCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAAAGC
ATCTTGGCCATCTGGGCTTGTCAAGTTGTGTTGATGGGAGCCGTTGAAGGTTACCGCATTGCTGGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318005] SGN-U589989 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130222 [Download][View] Facility Assigned ID: TFAEP03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5