Notice: Load is currently high due to bots. Some functionality has been turned off.

EST details — SGN-E315459

Search information 
Request: 315459Match: SGN-E315459
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C114052Clone name: cTOA-22-J13
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315459Length: 499 bp (964 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E315459 [] (trimmed) GCTTGATATCAGAAATAATACCCTTTCTGGCAATGTCCCTCAAGCCTTGAAGAGACTGAATGAAGGATTTCAGTATGCAAACAACCCTGACTTGT
GTGGAATTGAATTTTCTTCCTTGAAACTCTGCACTGTATCTAGTCTAAACCAAAACAGACCACAACCATTTGAACCTGGTTCGAATCGTCTCCCC
ACAAAAGACATTCCAGAGTCTGCAAATGTACAAACAAAACAAACGAGTCAGTCAAGAAAATCACAAACTGCTGTGGTTGTTGGTGTTATTGCACT
TTTTGTTGCAGTAGCTGTAACTGGACTTTTCACATTTTCGCTGTACCGTCGAAGGAAACAGAAAATTGGAGGTACTCTTGATACCTCCGATAGGC
GACTCAGTACTGATGAGGTGAAGGAGATTTCTAGAAGAAGCGCGTCGCCCCTCATCAGCCTGGAATATTCCAATGGCTGGGATCCTCTAAGGAAA
GGCCGANGTGGAAGTGCTTTCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315459] SGN-U597523 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T127486 [Download][View] Facility Assigned ID: TFADI55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5