Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E313393

Search information 
Request: 313393Match: SGN-E313393
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112036Clone name: cTOA-13-K15
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOA-13-K15.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E313393Length: 304 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E313393 [] (trimmed) TCAAAACTCACAATTTCGCCAACCACTCATTTTATTTCTTCATAAAAACCCTAAAAACACAATCGAACCCCAAAAATTGGTGTTGAAAGGAAGAG
TAACGATTTGGTTTTGAATTCAAGTTCAAATTCAGAGCATGGGGTGAAGAAGATTAGAAGAAGAAGATATACAGGTGACGAATTTCGTGATGGAG
TGGGATAGCAATTCGGATTTGAGTGGAGAAGAAGAAGATGGCGTTATTGAAGAAGAAGAAGTTGAGGATGAATTAGAGGAACTAGGGTTTATGTT
GAGTGGTGGTGGTTCAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E313393] SGN-U570563 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125675 [Download][View] Facility Assigned ID: TFABW68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5