EST details — SGN-E313393
Search information |
Request: 313393 | Match: SGN-E313393 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C112036 | Clone name: cTOA-13-K15 |
| ||
Library Name: cTOA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants
Microarray: This clone is not found on any microarray
This clone has been mapped as cTOA-13-K15.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E313393 | Length: 304 bp (932 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E313393 [] (trimmed)
TCAAAACTCACAATTTCGCCAACCACTCATTTTATTTCTTCATAAAAACCCTAAAAACACAATCGAACCCCAAAAATTGGTGTTGAAAGGAAGAG
TAACGATTTGGTTTTGAATTCAAGTTCAAATTCAGAGCATGGGGTGAAGAAGATTAGAAGAAGAAGATATACAGGTGACGAATTTCGTGATGGAG
TGGGATAGCAATTCGGATTTGAGTGGAGAAGAAGAAGATGGCGTTATTGAAGAAGAAGAAGTTGAGGATGAATTAGAGGAACTAGGGTTTATGTT
GAGTGGTGGTGGTTCAACT
TAACGATTTGGTTTTGAATTCAAGTTCAAATTCAGAGCATGGGGTGAAGAAGATTAGAAGAAGAAGATATACAGGTGACGAATTTCGTGATGGAG
TGGGATAGCAATTCGGATTTGAGTGGAGAAGAAGAAGATGGCGTTATTGAAGAAGAAGAAGTTGAGGATGAATTAGAGGAACTAGGGTTTATGTT
GAGTGGTGGTGGTTCAACT
Unigenes |
Current Unigene builds | |||||
[SGN-E313393] | SGN-U570563 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T125675 [Download][View] | Facility Assigned ID: TFABW68TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.927 | Expected Error Rate: 0.0109 | Quality Trim Threshold: 14.5 |