EST details — SGN-E309892

Search information 
Request: 309892Match: SGN-E309892
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98596Clone name: cLEZ-10-M17
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193423 [TUS-68-C21] Trace: SGN-T346241 EST: SGN-E545366 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193423 [TUS-68-C21] Trace: SGN-T350070 EST: SGN-E549195 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309892Length: 233 bp (1024 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309892 [] (trimmed) GCAAAAACCTCAACTTTCCTTCAAATTCTGCTCTATTTTCGATTCAGTGTTTTGGTTTTGGATTCAATTGCTGATAAAGATTTGTTTTTGAAAAT
GGTGTTAGTGTAAAGTGCTGCTGGAGTTTGATTTTGATTTGTTTGTTTGCGATGACGGGAACGGGAACAGGAACAGGAACAGGAATAGGAGGGGA
AGATGTTGATTACGAGAGCGATCCGGAGGAAGCCATGCTGTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309892] SGN-U584435 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122562 [Download][View] Facility Assigned ID: TRZBK81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5