EST details — SGN-E309244

Search information 
Request: 309244Match: SGN-E309244
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97632Clone name: cLEY-22-I1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193159 [TUS-67-H21] Trace: SGN-T345788 EST: SGN-E544913 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309244Length: 337 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E309244 [] (trimmed) GGCCAAACACCTTTGGCAACAGAATTCACAGGATGTTGAAACTCGGTTTGAGCATTGATGAGGAAAGCGGAAATGCTGATGCTGACATGCCAGCA
TTGGAGGATCCTGAAGCTGATGCTGAGGGCGACAAGATGGAGGATGTGGATGAAGTTCATTAATGTTATGATAGTTACATGGGTTCCTTTACTAC
TACTTTATGACCTAGTCTTTGCTTTATCCCATCAGAACAATATGTGAGGGTTCTAATGCCGAACTTTTACAATGGCAATTGAATGGGAGGATATA
ATTCTATTTTTTGCATTGACATTCGTGGTTGATACAACTGATTATCTTGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309244] SGN-U580166 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120949 [Download][View] Facility Assigned ID: TRYDG49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0227 Quality Trim Threshold: 12.5