Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E308268

Search information 
Request: 308268Match: SGN-E308268
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100306Clone name: cLEZ-6-K17
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100306 [cLEZ-6-K17] Trace: SGN-T121875 EST: SGN-E308267 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308268Length: 254 bp (390 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E308268 [] (trimmed) TTGGTAAGCAATTATTTGTGTAATGATCAGTTCACATCACTCTCTAATATGTCAACAGGTTCCACAAGATGATTCATGACTGATAAACTACAGGA
AATCGATGCATAAAATTGTATTTAGGAAGAGGATAACTCAAGTGATGATCCAAAATAACTTTGTTGTAACGGCTAACTCATTGAAGGCTTGAGCT
AGATCCAATGAGCACGCCAAATTTTATTAAAAACAAAAATGGAGCCCCCAATTCATTTGAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308268] SGN-U587408 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121876 [Download][View] Facility Assigned ID: TRZAU69TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0071 Quality Trim Threshold: 20.5