EST details — SGN-E307862
| Search information |
| Request: 307862 | Match: SGN-E307862 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C97308 | Clone name: cLEY-20-N2 |
| ||
| Library Name: cLEY | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: pre-anthesis/pre-fruit loading
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C193099 [TUS-67-F9] | Trace: SGN-T345684 | EST: SGN-E544809 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C193099 [TUS-67-F9] | Trace: SGN-T345685 | EST: SGN-E544810 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E307862 | Length: 157 bp (1040 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E307862 [] (trimmed)
GGTAAAATTCTATAGAGAAAAGCTGAAGTTCATATGAATTTCTTCCACAAAATCACATTTTTCTTAACAAAGTTTTGATTTTTAACGAATTTTTG
TTTGTATTATTTGATTTGATTTCTGGGTCTGTCTTCTTTTTTCATTTTTTTAAACATATAGA
TTTGTATTATTTGATTTGATTTCTGGGTCTGTCTTCTTTTTTCATTTTTTTAAACATATAGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E307862] | SGN-U582338 | Tomato 200607 | Build 2 | 22 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T120672 [Download][View] | Facility Assigned ID: TRYDB73TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.836 | Expected Error Rate: 0.0166 | Quality Trim Threshold: 14.5 |
Working
