EST details — SGN-E305139

Search information 
Request: 305139Match: SGN-E305139
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96834Clone name: cLEY-18-A1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193023 [TUS-67-C5] Trace: SGN-T345554 EST: SGN-E544679 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193023 [TUS-67-C5] Trace: SGN-T349957 EST: SGN-E549082 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305139Length: 493 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305139 [] (trimmed) GGAAAAACCTATCAGCAGCAGGCGGCGGCGGAGGAAAGTAGAAGCAGCAGGCGGAGCATCATGGGTATCGATCTAGTTGCCGGAGGTAAGTCCAA
AAAGACTAAGCGCATTGCACCAAAATCCGACGATGTTTATCTCAAGCTTCTCGTCAAGTTGTACCGATTTCTATCACGGAGGACTGGTAGTAAGT
TCAATGCTGTGATACTGAAGAGACTCTTCATGAGCAAGATCAATAAAGCTCCATTGTCTCTATCACGTTTGGTTACTGCATTGAGATTCACGGAA
ACAGCTAGAGCTAGGATTGAGAAGGCTGGAGGAGAATGTTTGACCTTTGATCAGCTTGCTCTCAGAGCCCCTCTTGGGCAGAACACTGTTTTGCT
TAGGGGTCCAAAGAACTCAAGGGAGGCCGTTAAGCACTTTGGTAAAGCACCTGGTGTCCCACACAGCCACACAAAGCCTTATGTTCGCGCAAAGG
GAAGGAAGTTTGAGCGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305139] SGN-U578394 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120379 [Download][View] Facility Assigned ID: TRYCQ01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0127 Quality Trim Threshold: 12.5