EST details — SGN-E304968

Search information 
Request: 304968Match: SGN-E304968
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92130Clone name: cLEX-10-D16
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304968Length: 287 bp (1216 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E304968 [] (trimmed) GCACATAGAACGCAGAATAAAAAAAAAGAAGACTAAAAAAGCTTCAATCTTTGTGAAAAAATGGCGGAAAACAAGGAAGAAGATGTTAAGCTTGG
AGCTAACAAGTTTAGGGAAACTCAACCATTAGGTACAGTAGCTCAAACAGACAAAGATTACAGAGAGCCACCACCATCTCCATTGTTTGAACCAA
GGGAGTTGTCATCATGGTACTTTTACAGGGCTGGTGTTGCTGAGCTCATGGCAACTTTATTGTTCTTGTGTATAACAATGTTGACTGTTATGGGT
CT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304968] SGN-U592929 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116742 [Download][View] Facility Assigned ID: TRXBN20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0328 Quality Trim Threshold: 14.5