EST details — SGN-E304916

Search information 
Request: 304916Match: SGN-E304916
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92336Clone name: cLEX-10-O20
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C184853 is on microarray TOM1: SGN-S1-1-6.2.14.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184853 [TUS-45-N19] Trace: SGN-T198743 EST: SGN-E397417 Direction: 3' Facility: INRA
Clone: SGN-C184853 [TUS-45-N19] Trace: SGN-T198744 EST: SGN-E397418 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304916Length: 490 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304916 [] (trimmed) GCGAGGATTGTTTTAAATGTTTAAGTATGGGCTGAAGGATCAGTTGAAGAGAAAGTGCAAAGGCTATTGAAGACTTGGGAAATGGAAATAGTCCA
TAAGGCAGATCCTAATGAGCTCAAAACTATGGATCCAAACAAGTTCACAATTAGTGTTAATGGTTACATTTTTCTCAAAATTTCTCTTACTCTTT
CCTAAAGGTATATGTGGTAAAAAAAATATATATTATTACAATTTTTTCATGTGTAATAAATTTTTAGAAAATTATTTTGTCTAGCGATTTTTTAT
CTTAAAAAATGAAGAAAATGAATACTTTAAAAGAAAATCATAAGTAAAGTTAGAGATAGAGTGAACTTTATTTTTATGAATTCTGAATTTAAGAA
TTATGACTATAAGAAAACTTCTATTTATTTTTCTTCAATAAACAAACAAAACACGCAAATCACCAATTTACTTACGTTAGATGGTCCACATCCAT
GTGGGAATACAATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304916] SGN-U589183 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116690 [Download][View] Facility Assigned ID: TRXBL94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5