EST details — SGN-E304572

Search information 
Request: 304572Match: SGN-E304572
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92532Clone name: cLEX-11-J5
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192406 [TUS-65-I12] Trace: SGN-T344495 EST: SGN-E543620 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304572Length: 332 bp (929 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E304572 [] (trimmed) GCAATGGTTTGCAAAATAATTTCTCTATCCTTTTTTTTTCCTTTGCTCCTCTTGTTCTCCCTCTCCTCAGCCAAAACACCTTCGAAACCTCGAGC
TTTTCTTCTTCCTATAACCAAAGATGAAGCCACTAAACAATTTATCACAACCATATACCAAAGAATACCCCTTGTCCCAGCCAAACTTACTATCG
ATCTTGGTCAACGATTTTTATGGGTTGATTGGGATATAGGTTATGTTAGTTCATCTTATAAACCTGTCCCTTGTGGTTCTATCCCTTGTAAACGT
TCTTTCTCCGGGGCATGTGTTGAATCATGTGGAGGTTCTCCTTCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304572] SGN-U570088 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116928 [Download][View] Facility Assigned ID: TRXBQ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0189 Quality Trim Threshold: 14.5