EST details — SGN-E301209
Search information |
Request: 301209 | Match: SGN-E301209 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C90443 | Clone name: cLEW-22-J12 |
| ||
Library Name: cLEW | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C191805 [TUS-63-P11] | Trace: SGN-T343458 | EST: SGN-E542583 | Direction: 5' | Facility: INRA (MWG) |
Clone: SGN-C191805 [TUS-63-P11] | Trace: SGN-T349612 | EST: SGN-E548737 | Direction: 3' | Facility: INRA (MWG) |
Sequence |
Sequence Id: SGN-E301209 | Length: 168 bp (1052 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E301209 [] (trimmed)
CGAGAGTTCAAAAAAGGACATTGGGTGGACTTCCACGTAAAATAAAAATCTTCACAACATGGGAACATTTGGACTCAATAATCGGTCTTGCATTT
ATATGAAGTTACCCACTTATTGAAGCAACAAAAAACATCAATTATTCATCCCATGCCAGAAAATCTACACTTT
ATATGAAGTTACCCACTTATTGAAGCAACAAAAAACATCAATTATTCATCCCATGCCAGAAAATCTACACTTT
Unigenes |
Current Unigene builds | |||||
[SGN-E301209] | SGN-U564259 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T114107 [Download][View] | Facility Assigned ID: TRDDJ54TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.887 | Expected Error Rate: 0.0245 | Quality Trim Threshold: 12.5 |