Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E300288

Search information 
Request: 300288Match: SGN-E300288
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89541Clone name: cLEW-17-M15
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300288Length: 401 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E300288 [] (trimmed) AGCTTTTTTCACATTATACAGCATCAAAATCATTTGCGGGGGTTGGGTAAAAAACTCTTTGTTATCCTTTCTATTTCTCACTTTGCCCCTCGATC
TTCGCTTCTTTGTCCCCTTTTTTCTGATTCCTCTGTCGAAACAAACCGAAACTTTTCCATTTATATAGAAAATATACGCGGATTTTGTTACTACT
ATGTATCCTACATTCATTGCCTTTTTTTTTTTAGTTTTTAATTGATCAATGGGGATCGATGACTTAATTTGTGATTTAGGGTTCTAATTCTTTAT
GGGTATTGGAAGATCGACCCGAGATTTTTTTTGTTTTTTGTTGAACGATGTAGCTGAATAAGACAATTGTTTGCTGCATAATCTTTAAATATTAG
TTGCTGAAGATGGGTCTTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300288] SGN-U589584 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113336 [Download][View] Facility Assigned ID: TRDCM80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0241 Quality Trim Threshold: 14.5