Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E299236

Search information 
Request: 299236Match: SGN-E299236
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86676Clone name: cLET-43-O21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191279 [TUS-62-J13] Trace: SGN-T342552 EST: SGN-E541677 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191279 [TUS-62-J13] Trace: SGN-T342555 EST: SGN-E541680 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299236Length: 502 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E299236 [] (trimmed) AGTGAAAGATTGGCCAAATGGCAGCAGTACCATCAGCTTCTACTTCCATGCGCGGCTACTGACGACTTTGCCTCTCCTTTCCCACTCTCCTCCAC
CACCAAAGCTGCCCCAGCTCGCTGCTCCGCCTTGCCTTACCTTCCATCCCGTCTTTCTGCTATTGCCTTCCCATCTTCTCTCAAAATTGCTGAGC
CCAAGAGGACTTCACTGCTCCAGGTCAAAGCCTCTTCATCAGAAGAATCTGGAACTGTTGATACTACTGAATTGCTGACGCATCTAAAAGAAAAG
TGGGATGCTCTCTACAACAAGTACTGCTGGAAGTGTTGATCAGGCTGATGGAAACTTGCTTGATGAGGACCAACAATCGGCGGGAGTGCTATCAA
CTCAGTTCCTTTGCTCCCAAAAATCATGGAGTTGGTAGGTCTTGGATATAGCGGGTGGTTTGTCTACCGCTACCTTCTCTTCAAGTCAAGTAGAA
AAGAACTGGCTGAAGATATCGAGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299236] SGN-U591700 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110977 [Download][View] Facility Assigned ID: TMEGM95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0301 Quality Trim Threshold: 12.5