EST details — SGN-E298001

Search information 
Request: 298001Match: SGN-E298001
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85270Clone name: cLET-38-L16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183639 is on microarray TOM1: SGN-S1-1-4.4.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183639 [TUS-42-L5] Trace: SGN-T200375 EST: SGN-E399404 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298001Length: 444 bp (1609 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298001 [] (trimmed) GTTCTCTGTTGTCTTCTCTCTCTCTACCTTCTATATTCTGAAGGGTCAATTCTTGAACAAAATTTTGGAAGCAAAAAGAAGAAACCCCTTTGAGG
TTGCTGGTTTTTTTCAAACCAAAATTTGGCTGCCAAGATGATGATGTTTGAAGACATTGGGTTTTGTGCTGATCTTGATTTCTTCCCTGCTCCGC
TGAAGGAGGCGGAAACAGTAGCTGCTGTTCCACCAATTGTGCCGGAGCCGATGATGGATGATGATGATAGTGATGAGGAGATCGATGTGGATGAG
CTGGAGAAGAGGATGTGGAGGGATAAGATGAAGCTGAAAAGGCTGAAAGAAATGAGCAAGGGCAAGGAAGGTGTTGATGCTGTCAAACAACGCCA
GTCTCAGGAGCAAGCTAGGAGGAAGAAGATGTCCAGGGCTCAAGATGGGATCTTGAAGTACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298001] SGN-U585765 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110080 [Download][View] Facility Assigned ID: TMEFV68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5