EST details — SGN-E297678

Search information 
Request: 297678Match: SGN-E297678
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84413Clone name: cLET-28-L18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184772 is on microarray TOM1: SGN-S1-1-7.3.14.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E297678Length: 426 bp (978 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E297678 [] (trimmed) GTCAAGTGCAGTGCATCAGTTTTATTTCTTACAAGCCCGAAGGATACTAAGGGGTAGAAAAACTAATTGCCCTATGTTTATACGGACAGTTTGTT
TGAATTCTCCTTTGGGTTTTCCCTTGAGAAAATGAATACAATTGCCATCCAGCTCTCGATTGATCATGAACCAAACACCGAACGAGATGACATTG
AAAACAGAGGTGGTTTCGTCTCAAACATGCCAGGAGATGTTGCTAGAGTGAATGGCCAACTAGCTGTATCTCGAGCTTTTGGTGACAAAAACTTG
AAATCACATTTGAGCTCTGATCCTGATGTAACAAATGCTGATGTTGATGCGGAAACAGATCTTCTCATACTTGCAAGTGATGGTCTATGGAAGGT
AATGTCTAATCAAGAGGCAGTAGACATTGGGAGGAAGGCTCAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E297678] SGN-U591593 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109472 [Download][View] Facility Assigned ID: TMEEH69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5