EST details — SGN-E295191

Search information 
Request: 295191Match: SGN-E295191
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82709Clone name: cLET-20-P5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181920 is on microarray TOM1: SGN-S1-1-3.4.10.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295191Length: 343 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295191 [] (trimmed) CTACACCTCCAGTTTCCTTCAACTCCAGAGATAATGAATCGTTGGGTTGGGTCAATATTTCTGTGCATTATCAACACATTGCTTCTGACGAGCTG
GTTGGTGGCGGCGGAGGGGGAGACATGCTCGGGGATAGTACCAATGCAATATCGAAATGATAAGACATCGATATTGGACTTTGGAGGTGTAGGTG
ATGGGCGGACATTGAATACAAAAGCGTTTAAAGAAGCAATCTTTAGAATTCACCACTTGAAGAGGAAGGGAGGAACTTGGCTATACATACCTGCT
GGGGTATATTAGACTGGCCCATTCGATCTTACTAATCGAATGACTCTTTATTTGGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295191] SGN-U580563 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107605 [Download][View] Facility Assigned ID: TMEDA87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0282 Quality Trim Threshold: 14.5