Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E293020

Search information 
Request: 293020Match: SGN-E293020
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80515Clone name: cLET-12-H8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190843 [TUS-61-H9] Trace: SGN-T341803 EST: SGN-E540928 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190843 [TUS-61-H9] Trace: SGN-T341806 EST: SGN-E540931 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293020Length: 304 bp (788 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293020 [] (trimmed) GAAGATGCCAGCATGCTGTGTGTAAACCTGGGACTTGTCCGCGATCCATTTAGACAGTACATGCCTATATGAGACCTCTTGGAGTAGTTGCTATG
ATTTTGGGCATTGATGAGGAGAAAGGGCCCCAGCTCTTCAAACGCGACCCTGCTGGTCATTTTTTTGGTCATAAGGCTACAAGTGCCGGATCTAA
AGAGCATGAGGCAATTAACTGTTTGGAGAAGAAAATGAATAATAACCCTGCGTTCTCCTATGAGGAAACTGTTCAGACCACTATCTCTGCTCTTC
AATCTGTTCTGCAAGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293020] SGN-U565095 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105483 [Download][View] Facility Assigned ID: TMEBV40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0101 Quality Trim Threshold: 20.5