EST details — SGN-E291113

Search information 
Request: 291113Match: SGN-E291113
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88635Clone name: cLET-8-O16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190783 [TUS-61-E21] Trace: SGN-T341703 EST: SGN-E540828 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291113Length: 419 bp (631 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291113 [] (trimmed) ATCATCAGTAGAGCTTGCATTGAACATGCAATCCACTGATCTCTCTGAATGTCTTTCTGGGATTTCACATGATGACGTGACGAAGCAAGATGCCT
CGGTTTGGTACTAGCAATGCGATTACTCAAATGAACATCAAGCAGTGGATATCACAATATACCTTTAATCAGGTGGATTTCAGTTTGCCTATAGT
TCTCAGTTTGGGTTTTCTGTTACCATGTAGTTGTAGAGGTTGGAGGATCGTGCATGACGTTATTACAAGGGAGTAGTAAGAGATGTCATGCTGCT
GGTTAGAAGGAACTTATAGATGTTTCTAAATAAGGTTTAGCAGTCAGTTTATTTTCATATATGTCTATAACTCTATATAGGTTTTAGCTTTATCC
CATAGTCAATCGTTGGTTTCGGAGATATTTAAACGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291113] SGN-U585765 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104509 [Download][View] Facility Assigned ID: TMEBD92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5